Technical information

Rebecca Barnes and Melanie Stapleton

Day 1

ITEM AMOUNT NOTES
PER PAIR
P1 plasmid
(pGEX-KG; ampR)
6 μl at 100 ng/ μl
P2 plasmid
(pTOPO+1kb; kanR)
6 μl at 100 ng/ μl
LB + amp plates 2 Stripe red
LB + kan plates 2 Stripe blue
TFB1 1.5 ml See below for recipe

On ice

TFB2 0.5 ml See below for recipe

On ice

DH5⍺ at OD600nm = 0.3-0.6 3 ml On ice
LB broth 5 ml
10 μM primers:

amp-F, amp-R, kan-F, kan-R

20 μl each On ice

Details below

2X DreamTaq PCR Mastermix with dye 125 μl On ice
Alcohol bath & spreader 1 Use IMS, not ethanol
PER BAY (16 students)
Sterile 1.5 ml eppendorfs 1 box per side
(enough for whole day)
Sterile 0.5 ml eppendorfs 1 box per side
(enough for whole day)
Virkon pots 1 between 2 pairs
EQUIPMENT
Hotblocks at 37 oC
OTHER
A way to collect in 4 plates per pair.  Incubate at 37 oC overnight (or 25 oC over the weekend), then store at 4 oC
Ice bucket per bay with sponges (labelled by group & bay) for 32 x 0.5 ml PCR tubes.

Load and run PCR machine, then store reactions in freezer until next session

See below for PCR programme details
Keep any leftover amp/kan plates, TFB1 & 2, LB broth; anyone not getting good transformations will repeat during the next session

 

TFB1: for 100 ml

30 mM potassium acetate pH 7.5 3 ml of 1M stock

100 mM RbCl 1.2 g

50 mM MnCl2.4H2O 0.99 g

10 mM CaCl2 0.11 g

→ adjust pH to 5.8 with acetic acid; filter sterilise; store at 4o

 

TFB2: for 100 ml

10 mM MOPS pH 6.8 2 ml of 0.5 M stock

10 mM RbCl 0.12 g

75 mM CaCl2 0.825 g

→ adjust pH to 6.8 with KOH; filter sterilise; store at 4o

 

Primer sequences

AmpF: TGATAACACTGCGGCCAACT

AmpR: GTGAGGCACCTATCTCAGCG

KanF: TGAACTCCAAGACGAGGCAG

KanR: GGTAGCCAACGCTATGTCCT

 

PCR programme details

1 x 95 oC / 5 min

30 x (95 oC / 1 min ; 55 oC / 1 min ; 72 oC / 1 min)

1 x 72 oC / 10 min

Day 2

ITEM AMOUNT NOTES
PER PAIR
P1 plasmid
(pGEX-KG; ampR)
15 μl at 100 ng/ μl On ice
P2 plasmid
(pTOPO+1kb; kanR)
15 μl at 100 ng/ μl On ice
EcoRV (Promega) 3 μl On ice
SmaI (Promega) 3 μl On ice
Enzyme buffer

(Promega Multi-core)

8 μl On ice
PER BAY
Gel equipment for 2 gels per bay 2 x 250 ml conical flasks (with 25 ml flasks in the top), 2 x 100 ml cylinder, 1 x 2 L beaker for collecting TAE2 x gel trays, 2 x 20-well combs, 2 x gel tanks & lids, 2 x lane sheets
Midori Green Tube per bay Put out with sign telling them not to throw away the tube
1 kb GeneRuler Tube per bay Put out with sign telling them not to throw away the tube
EQUIPMENT
Hotblocks at 37 oC
Waterbaths at 52 oC
OTHER
1 x 20 L tank of 1X TAE available in lab
Plates from previous session
PCR reactions from previous session See below for expected results
Ice box with sponges (labelled with group & bay – can use the ones containing the PCR reactions) to collect in 4 x restriction digest tubes per pair.  Freeze these until the next session
On spares trolley put some:

  • DH5⍺ at OD600nm = 0.3-0.6
  • amp/kan plates
  • TFB1 & 2
  • LB broth
  • Virkon pots
  • alcohol baths & spreaders

(as for yesterday)

  • bottle of IMS for alcohol baths

Anyone not getting good transformations will repeat during today’s session

Incubate their plates at 37 oC

Day 3

ITEM AMOUNT NOTES
PER BAY
Gel equipment for 2 gels per bay 2 x 250 ml conical flasks (with 25 ml flasks in the top), 2 x 100 ml cylinder, 1 x 2 L beaker for collecting TAE, 2 x gel trays, 2 x 20-well combs, 2 x gel tanks & lids, 2 x lane sheets
Midori Green Tube per bay Put out with sign telling them not to throw away the tube
1 kb GeneRuler Tube per bay Put out with sign telling them not to throw away the tube
EQUIPMENT
Waterbaths at 52 oC
OTHER
1 x 20 L tank of 1X TAE available in lab
Students’ digests from yesterday On ice
Return any transformation re-attempts from yesterday

 

For access to plasmids, please contact Mel Stapleton (m.stapleton@sheffield.ac.uk)

Plasmid maps here.

Licence

Icon for the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License

Cat burglars, yeast races, and other hypothesis-driven bioscience practicals Copyright © 2024 by The authors and the University of Sheffield is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License, except where otherwise noted.