Student-facing materials

Rebecca Barnes and Melanie Stapleton

Document 1: Overview

This practical will provide you with some experience of experimental planning. You will apply what you have already learnt about molecular cloning to design and carry out experiments to identify two plasmids.

We will provide you with two plasmids, based on the cloning vectors pGEX-KG (containing an ampicillin resistance cassette) and pTOPO (containing a kanamycin resistance cassette). However, we have only labelled these p1 and p2. Your task is to tell us which one is which using three strategies: (i) selection of transformed bacteria on different antibiotics; (ii) diagnostic restriction digest; (iii) PCR amplification of the antibiotic resistance genes. You have plasmid maps, sequences, and some protocols to help you. In the first session, you will plan your experiments for the rest of the project. You will then carry out the experiments and analyse the results over the next three lab sessions.

Key things to understand:

  1. Use of complementary approaches to identify unknown plasmids

New practical skills:

  1. Experimental design and planning
  2. PCR primer design

Before Session 1

Things to read (~30 minutes): [included later in this section]

  • Instruction document for the planning session
  • Guide to primer design

Things to do (~30 minutes):

  • Review the material on PCR and restriction mapping from [module]
  • Locate the protocol and plasmid map documents on [VLE]

Session 1: planning your experiments

After a brief introduction talk, you will work in your pairs to plan your experiments for the next three sessions and fill in the experimental plan document. Before you leave the lab, you should go through your plans with a member of staff.

Sessions 2-4: carrying out your experiments

You will perform the experiments you planned in Session 1. Materials will be available as follows:

Session Materials available
1 Planning all your experiments (no bench work)
2 Transformation and PCR (up to 4 plates and 4 PCR reactions)
3 Electrophoresis, restriction digests, and transformation repeats
4 Electrophoresis, writing exercises
NB, you will be able to repeat your transformations if you did not get a clear result.

Document 2: Planning Session (day 1)

In this session, after a brief introduction, you will be planning your experiments for the next three sessions. Your aim is to identify, out of p1 and p2, which is pGEX-KG and which is pTOPO. You will be able to gather a lot of useful information, such as the antibiotic resistance cassettes found on each plasmid and the restriction sites they hold, by looking at the plasmid maps.

By making predictions today on results you would expect for pGEX-KG and pTOPO in various situations, and comparing the results you actually get for p1 and p2 to these ideal results, you will be able to identify which is which.

[You will be working on a paper copy of the Experimental Plan handout[Document 3 below] (provided in the lab).]

Transformation

  • In the “predictions” section, fill in the grey boxes with the predicted results for each of the plasmids when grown in the presence of different antibiotics: do you expect to see any colonies growing on the plate?
  • In the “our experiment” section, fill in the grey boxes to plan the transformations you will carry out. You can choose which plasmid(s) and which antibiotic to use. Antibiotic plates will be made for you. We have enough materials for each pair to use four plates.

PCR

  • Calculate how to dilute your plasmid to the required concentration. Bear in mind that you will only be provided with a few microlitres of plasmid.
  • Design primers to amplify a ~500 bp section of Ampicillin and of Kanamycin, following the guidelines in the Guide to Primer Design document [Document 5 below]. Draw the primers on the handout.
  • We obviously can’t order a separate set of primers for each pair, so we’ll be providing you with forward and reverse primers for each resistance gene to carry out your experiments: we have called these AMPF, AMPR, KANF and KANR. In the “predictions” section, fill in the grey boxes with predicted results for each primer combination indicated.
  • In the “our experiment” section, plan primer and plasmid combinations. We have enough materials for each pair to do four reactions. Think about positive and negative controls; although you only have four reactions, try to ensure that there will be some reactions that should definitely have a product and some that will be blank (even if you can’t predict which they will be).

Restriction digests

  • In the “predictions” section, use the plasmid maps provided to fill in the grey boxes with the predicted results for each of the plasmid and enzyme combinations shown. You should be able to predict the DNA fragment sizes.
  • In the “our experiment” section, fill in the grey boxes to plan the digests you will carry out. We have enough materials for each pair to do four digests.

Go through your experimental plan handout with a member of staff before you leave. 

Document 3: Experimental plan [we suggest to be provided as a paper copy]

Grey boxes to be completed in the planning session and checked with a member of staff before you leave the lab.
White boxes to be completed as you gather your data.

Method 1: transformation

Predictions

Antibiotic Predicted result for pGEX-KG
(will the cells grow? Yes or no)
Predicted result for pTOPO
(will the cells grow? Yes or no)
Amp
Kan

Our experiment

Plate Plasmid
(p1 or p2)
Antibiotic
(amp or kan)
Colonies observed
(number of colonies)
Consistent with pGEX or pTOPO?
1
2
3
4

Method 2: PCR

Plasmid dilution

In the space below, design a scheme for diluting plasmids from 100 ng.µl-1 to 0.1 ng.µl-1. You will be given 3 μl of each plasmid.

Primer design

On the following pages are the sequences for the ampicillin and kanamycin resistance cassettes. Mark the primers you have designed on the double-stranded ORF sequence, and write the primer sequences (5’-3’), in the space provided.

Predictions

Sequences of the primers we will give you:
AmpF: TGATAACACTGCGGCCAACT, AmpR: GTGAGGCACCTATCTCAGCG. Product of ~450 bp.
KanF: TGAACTCCAAGACGAGGCAG, KanR: GGTAGCCAACGCTATGTCCT. Product of ~500 bp.

Names of primers Predicted product for pGEX-KG Predicted product for pTOPO
1 AMPF

2 AMPR

1 KANF

2 KANR

No primers
All four primers

Our experiment

Tube Plasmid
(p1 or p2)
Names of primers Bands observed
(sizes in bp)
Consistent with pGEX or pTOPO?
1
2
3
4

[DNA sequences below should align if you change the font to Courier]

Ampicillin

5 atgagtattcaacatttccgtgtcgcccttattcccttttttgcggcatt
3 tactcataagttgtaaaggcacagcgggaataagggaaaaaacgccgtaa

5 ttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatg
3 aacggaaggacaaaaacgagtgggtctttgcgaccactttcattttctac

5 ctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaac
3 gacttctagtcaacccacgtgctcacccaatgtagcttgacctagagttg

5 agcggtaagatccttgagagttttcgccccgaagaacgttttccaatgat
3 tcgccattctaggaactctcaaaagcggggcttcttgcaaaaggttacta

5 gagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacg
3 ctcgtgaaaatttcaagacgatacaccgcgccataatagggcacaactgc

5 ccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttg
3 ggcccgttctcgttgagccagcggcgtatgtgataagagtcttactgaac

5 gttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagt
3 caactcatgagtggtcagtgtcttttcgtagaatgcctaccgtactgtca

5 aagagaattatgcagtgctgccataaccatgagtgataacactgcggcca
3 ttctcttaatacgtcacgacggtattggtactcactattgtgacgccggt

5 acttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttg
3 tgaatgaagactgttgctagcctcctggcttcctcgattggcgaaaaaac

5 cacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagct
3 gtgttgtaccccctagtacattgagcggaactagcaacccttggcctcga

5 gaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaa
3 cttacttcggtatggtttgctgctcgcactgtggtgctacggacgtcgtt

5 tggcaacaacgttgcgcaaactattaactggcgaactacttactctagct
3 accgttgttgcaacgcgtttgataattgaccgcttgatgaatgagatcga

5 tcccggcaacaattaatagactggatggaggcggataaagttgcaggacc
3 agggccgttgttaattatctgacctacctccgcctatttcaacgtcctgg

5 acttctgcgctcggcccttccggctggctggtttattgctgataaatctg
3 tgaagacgcgagccgggaaggccgaccgaccaaataacgactatttagac

5 gagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagat
3 ctcggccactcgcacccagagcgccatagtaacgtcgtgaccccggtcta

5 ggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaac
3 ccattcgggagggcatagcatcaatagatgtgctgcccctcagtccgttg

5 tatggatgaacgaaatagacagatcgctgagataggtgcctcactgatta
3 atacctacttgctttatctgtctagcgactctatccacggagtgactaat

5 agcattggtaa
3 tcgtaaccatt

Primer name Sequence (5’-3’)

Important!: also mark your primers onto the DNA sequence above.

 

Kanamycin

5 atgattgaacaagatggattgcacgcaggttctccggccgcttgggtgga
3 tactaacttgttctacctaacgtgcgtccaagaggccggcgaacccacct

5 gaggctattcggctatgactgggcacaacagacaatcggctgctctgatg
3 ctccgataagccgatactgacccgtgttgtctgttagccgacgagactac

5 ccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaag
3 ggcggcacaaggccgacagtcgcgtccccgcgggccaagaaaaacagttc

5 accgacctgtccggtgccctgaatgaactccaagacgaggcagcgcggct
3 tggctggacaggccacgggacttacttgaggttctgctccgtcgcgccga

5 atcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttg
3 tagcaccgaccggtgctgcccgcaaggaacgcgtcgacacgagctgcaac

5 tcactgaagcgggaagggactggctgctattgggcgaagtgccggggcag
3 agtgacttcgcccttccctgaccgacgataacccgcttcacggccccgtc

5 gatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggc
3 ctagaggacagtagagtggaacgaggacggctctttcataggtagtaccg

5 tgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcg
3 actacgttacgccgccgacgtatgcgaactaggccgatggacgggtaagc

5 accaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagcc
3 tggtggttcgctttgtagcgtagctcgctcgtgcatgagcctaccttcgg

5 ggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgcc
3 ccagaacagctagtcctactagacctgcttctcgtagtccccgagcgcgg

5 agccgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatc
3 tcggcttgacaagcggtccgagttccgcgcctacgggctgccgctcctag

5 tcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaat
3 agcagcactgggtaccgctacggacgaacggcttatagtaccacctttta

5 ggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccg
3 ccggcgaaaagacctaagtagctgacaccggccgacccacaccgcctggc

5 ctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcg
3 gatagtcctgtatcgcaaccgatgggcactataacgacttctcgaaccgc

5 gcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgat
3 cgcttacccgactggcgaaggagcacgaaatgccatagcggcgagggcta

5 tcgcagcgcatcgccttctatcgccttcttgacgagttcttctga
3 agcgtcgcgtagcggaagatagcggaagaactgctcaagaagact

Primer name Sequence

Important!: also mark your primers onto the DNA sequence above.

Method 3: restriction digest

Predictions: number of bands + sizes

Enzymes Predicted fragments for pGEX-KG
(sizes in kb)
Predicted fragments for pTOPO
(sizes in kb)
EcoRV
SmaI
EcoRV + SmaI

Our experiment

Tube Plasmid
(p1 or p2)
Enzymes
(SmaI and/or EcoRV)
Bands observed Consistent with pGEX or pTOPO?
1
2
3
4

 

To-do lists

Day 2

Day 3

Day 4

 

Document 4: Protocols

Transformation

Materials available

  • LB plates containing 1) ampicillin at 100 µg/ml (striped red), 2) kanamycin at 50 µg/ml (striped blue): you may use two of each
  • Plasmids at 100 ng/µl
  • E. coli in exponential growth, buffers TFB1 and TFB2

For risk assessment information for this session please refer to [see Safety Information section in appendix for suggested wording. See the sections headed “Use of bunsens for sterile technique” and “Flaming with ethanol (sterilization of plate spreaders)”.]

 

Protocol

Note that a single transformation will give you enough sample to spread over several plates: you need only carry out one transformation for each plasmid.

  1. For the transformations, transfer 1 ml E. coli to each of two 1.5 ml Eppendorf tubes
  2. Centrifuge at full speed for 30 sec. Remove the supernatant
  3. Add 450 µl buffer TFB1 to each tube and gently resuspend by pipetting up and down (do not vortex), taking care to keep everything on ice. Incubate on ice for 10 min
  4. Pellet the bacteria by centrifugation at full speed for 30 sec, and remove the supernatant. Gently resuspend the pellets as before in 100 µl cold buffer TFB2 and incubate on ice for 10 min
  5. Add 100 ng of the appropriate plasmid DNA (you should calculate the volume – check your calculation with a staff member before proceeding) to the competent cells and mix gently. Do not vortex!  Keep the remainder of your plasmid to dilute for the PCR experiment
  6. Heat-shock the cells by transferring them directly from the ice to a 37oC hotblock for 5 min. Incubate on ice for 5 min and then add 1 ml LB broth to each tube
  7. Incubate at 37oC for 30 min to allow the cells to recover
  8. Pellet the bacteria by centrifugation at full speed for 30 sec. Discard the supernatant.  Resuspend the pellet in 400 µl of LB
  9. Spread 100 µl cells per plate onto the appropriate antibiotic plates (therefore, you can use a single transformation for more than one plate)
  10. Put your plates in the tray at the end of your bay; they will be incubated overnight for you at 37oC

2) PCR

Materials available

  • Primers amp-F and amp-R, kan-F and kan-R.
  • A commercially available PCR Master Mix at 2X concentration (containing Taq polymerase buffer, 1.5 mM MgCl2, 0.2 mM each of dATP, dCTP, dGTP and dTTP, Taq polymerase, and a red dye to allow direct loading of the completed reaction onto an agarose gel)
  • Plasmids at 100 ng/µl; you will need to dilute this DNA to a working concentration of 0.1 ng/µl before you use them

 

Protocol

First day:
Add the following to a 0.5 ml tube:

1 ng DNA: ?? µl of your 0.1 ng.µl-1 dilution (check your calculation with a staff member)
Primer 1 5 µl
Primer 2 5 µl
2X PCR Master Mix 25 µl
H2O ?? µl

Total volume 50 µl

Place your (carefully labelled!) tubes in the ice bucket at the end of your bay.
The following program will be used:

  • 1 cycle 94oC 1 min
  • 30 cycles (94oC 1 min – 55oC 1 min – 72oC 1 min)
  • 1 cycle 72oC 5 min

Second day: load 10 µl of each of your reactions onto a 1% agarose gel.  Note that the PCR Master Mix contains a coloured dye for direct loading – there is no need to add any additional loading dye.  You will need to share a gel with other pairs; you may run up to 4 lanes on a gel (not including markers). Ensure that there are markers on all gels! Remember to make a note of which lanes your samples are in, on the sheet next to the gel tank.  Run the gel at 100 V for 1 h. Once you have poured the gel please rinse out the flask immediately as it makes it much easier to wash.

For risk assessment information for this session, refer to [see Safety Information section in appendix for suggested wording. See the section headed “Preparation of agarose gel and Gel electrophoresis”.]

3) Restriction Digests

Materials available:

    • Restriction digest buffer
    • Plasmids at 100 ng/µl
  • Restriction enzymes SmaI and EcoRV

Protocol:
First day:
For each digest, add the following to a 1.5 ml tube:

250 ng DNA 2.5 µl
Restriction buffer 1 µl
H2O 5.5 µl (or 6 µl)
Enzyme 1 0.5 µl
(Enzyme 2 0.5 µl – if required)
Total volume 10 µl

Incubate at 37 oC for 60 min, then place in the rack at the end of your bay. The reactions will be stored in the freezer for you until tomorrow

Second day: add 2 µl of 6X loading dye to each sample and load onto a 1% agarose gel. You will need to share a gel with other pairs; each group may run up to 4 lanes on a gel (not including markers). Ensure that there are markers on all gels! Remember to make a note of which lanes your samples are in on the sheet next to the gel tank. Once you have poured the gel please rinse out the flask immediately as it makes it much easier to wash.

For risk assessment information for this session please refer to [see appendix]. See the section headed “Preparation of agarose gel and Gel electrophoresis”.

Document 5: Guide to Primer Design

In this mini-project you are asked to 1) design primers to amplify a section of the ampicillin and kanamycin resistance cassettes, and 2) predict whether primers against the amp and kan cassettes will be able to use pGEX and pTOPO as templates.
Below are a few notes about primer design.

Orientation

Two primers are necessary for PCR amplification. Each will anneal to one of the strands of the double-stranded template. Remember to think about the orientation of the primer sequence in relation to DNA synthesis: nucleotides are added to the 3’ end of the primer. Primers must be the reverse complement of the sequence to which you want them to hybridise. Primer sequences should always be written 5’-3’. I have shown an example of how the primers should look using the example below.

ds DNA molecule:

5’ atgtaccgtaggctaagctagcggtagcgta…gcttgcatgctaggctcgatatagatctgccc 3’
3’ tacatggcatccgattcgatcgccatcgcat…cgaacgtacgatccgagctatatctagacggg 5’

“Forward” primer (binds to a sequence on the “bottom” strand): 5’ atgtaccgtaggctaagcta 3’

3’ tacatggcatccgattcgatcgccatcgcat…cgaacgtacgatccgagctatatctagacggg 5’
5’ atgtaccgtaggctaagcta 3’

“Reverse” primer (binds to a sequence on the “top” strand): 5’ gggcagatctatatcgagcc 3’

5’ atgtaccgtaggctaagctagcggtagcgta…gcttgcatgctaggctcgatatagatctgccc 3’
3’                                                                                               ccgagctatatctagacggg 5’

Positioning of the primers

Sometimes the positioning of primers has to be very precise, for example if a gene is being amplified for cloning into an expression vector. However, in this case we don’t really mind where the primers anneal to the template; we just want to generate a product for diagnostic purposes. Therefore you can design the primers wherever you like towards the ends of the ORFs. We would like the PCR product to be about 500 bp in length.

Primer length

In general, primers should be between 18 and 22 nucleotides long. For today, please design primers that are 20 nt in length.

Melting temperature

The melting temperature (Tm) of a PCR primer corresponds to the temperature at which the primer will no longer form base pairs with its complement, and therefore dissociate. This is because hydrogen bonds are disrupted as temperatures increase. As G-C base pairs are joined by three hydrogen bonds whereas A-T base pairs are joined by only two, DNA with higher GC content will have a higher melting temperature. The annealing temperature of the PCR program should be about 5oC lower than the melting temperature.

We can estimate the melting temperature using the following equation: Tm = 4(G + C) + 2(A + T) °C. For example, for a primer with the sequence 5’ ATGCCGTATTGCCAACTCGG 3’, there are 5 G, 6 C, 4 A, and 5 T bases; therefore Tm = 4(5+6) + 2(4+5) oC = 62oC.

You should aim for a Tm between 55 and 60oC. The Tm for your forward and reverse primers should be as close as possible to each other.

 

Licence

Icon for the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License

Cat burglars, yeast races, and other hypothesis-driven bioscience practicals Copyright © 2024 by The authors and the University of Sheffield is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License, except where otherwise noted.