Technical information
Rebecca Barnes and Melanie Stapleton
Day 1
| ITEM | AMOUNT | NOTES |
| PER PAIR | ||
| P1 plasmid (pGEX-KG; ampR) |
6 μl at 100 ng/ μl | |
| P2 plasmid (pTOPO+1kb; kanR) |
6 μl at 100 ng/ μl | |
| LB + amp plates | 2 | Stripe red |
| LB + kan plates | 2 | Stripe blue |
| TFB1 | 1.5 ml | See below for recipe
On ice |
| TFB2 | 0.5 ml | See below for recipe
On ice |
| DH5⍺ at OD600nm = 0.3-0.6 | 3 ml | On ice |
| LB broth | 5 ml | |
| 10 μM primers:
amp-F, amp-R, kan-F, kan-R |
20 μl each | On ice
Details below |
| 2X DreamTaq PCR Mastermix with dye | 125 μl | On ice |
| Alcohol bath & spreader | 1 | Use IMS, not ethanol |
| PER BAY (16 students) | ||
| Sterile 1.5 ml eppendorfs | 1 box per side (enough for whole day) |
|
| Sterile 0.5 ml eppendorfs | 1 box per side (enough for whole day) |
|
| Virkon pots | 1 between 2 pairs | |
| EQUIPMENT | ||
| Hotblocks at 37 oC | ||
| OTHER | ||
| A way to collect in 4 plates per pair. Incubate at 37 oC overnight (or 25 oC over the weekend), then store at 4 oC | ||
| Ice bucket per bay with sponges (labelled by group & bay) for 32 x 0.5 ml PCR tubes.
Load and run PCR machine, then store reactions in freezer until next session |
See below for PCR programme details | |
| Keep any leftover amp/kan plates, TFB1 & 2, LB broth; anyone not getting good transformations will repeat during the next session |
TFB1: for 100 ml
30 mM potassium acetate pH 7.5 3 ml of 1M stock
100 mM RbCl 1.2 g
50 mM MnCl2.4H2O 0.99 g
10 mM CaCl2 0.11 g
→ adjust pH to 5.8 with acetic acid; filter sterilise; store at 4o
TFB2: for 100 ml
10 mM MOPS pH 6.8 2 ml of 0.5 M stock
10 mM RbCl 0.12 g
75 mM CaCl2 0.825 g
→ adjust pH to 6.8 with KOH; filter sterilise; store at 4o
Primer sequences
AmpF: TGATAACACTGCGGCCAACT
AmpR: GTGAGGCACCTATCTCAGCG
KanF: TGAACTCCAAGACGAGGCAG
KanR: GGTAGCCAACGCTATGTCCT
PCR programme details
1 x 95 oC / 5 min
30 x (95 oC / 1 min ; 55 oC / 1 min ; 72 oC / 1 min)
1 x 72 oC / 10 min
Day 2
| ITEM | AMOUNT | NOTES |
| PER PAIR | ||
| P1 plasmid (pGEX-KG; ampR) |
15 μl at 100 ng/ μl | On ice |
| P2 plasmid (pTOPO+1kb; kanR) |
15 μl at 100 ng/ μl | On ice |
| EcoRV (Promega) | 3 μl | On ice |
| SmaI (Promega) | 3 μl | On ice |
| Enzyme buffer
(Promega Multi-core) |
8 μl | On ice |
| PER BAY | ||
| Gel equipment for 2 gels per bay | 2 x 250 ml conical flasks (with 25 ml flasks in the top), 2 x 100 ml cylinder, 1 x 2 L beaker for collecting TAE2 x gel trays, 2 x 20-well combs, 2 x gel tanks & lids, 2 x lane sheets | |
| Midori Green | Tube per bay | Put out with sign telling them not to throw away the tube |
| 1 kb GeneRuler | Tube per bay | Put out with sign telling them not to throw away the tube |
| EQUIPMENT | ||
| Hotblocks at 37 oC | ||
| Waterbaths at 52 oC | ||
| OTHER | ||
| 1 x 20 L tank of 1X TAE available in lab | ||
| Plates from previous session | ||
| PCR reactions from previous session | See below for expected results | |
| Ice box with sponges (labelled with group & bay – can use the ones containing the PCR reactions) to collect in 4 x restriction digest tubes per pair. Freeze these until the next session | ||
On spares trolley put some:
(as for yesterday)
Anyone not getting good transformations will repeat during today’s session |
Incubate their plates at 37 oC |
Day 3
| ITEM | AMOUNT | NOTES |
| PER BAY | ||
| Gel equipment for 2 gels per bay | 2 x 250 ml conical flasks (with 25 ml flasks in the top), 2 x 100 ml cylinder, 1 x 2 L beaker for collecting TAE, 2 x gel trays, 2 x 20-well combs, 2 x gel tanks & lids, 2 x lane sheets | |
| Midori Green | Tube per bay | Put out with sign telling them not to throw away the tube |
| 1 kb GeneRuler | Tube per bay | Put out with sign telling them not to throw away the tube |
| EQUIPMENT | ||
| Waterbaths at 52 oC | ||
| OTHER | ||
| 1 x 20 L tank of 1X TAE available in lab | ||
| Students’ digests from yesterday | On ice | |
| Return any transformation re-attempts from yesterday |
For access to plasmids, please contact Mel Stapleton (m.stapleton@sheffield.ac.uk)
